Board List | |
---|---|
Topic | We should invent a language the mods don't understand. |
MrMallard 09/10/23 8:25:15 AM #35 | We should start speaking in genome sequences. ATGATACTGATGCATACGTACGTACGATCATCG |
Topic | Finally tried anchovies on pizza for the first time. |
MrMallard 09/10/23 6:46:19 AM #17 | They're very rich, I'll give you that. I like very bold flavors like salami, pickled onions and garlic, so anchovies are an occasional treat I like to have on pizza. It's like Vegemite; you use anchovies sparingly and it helps in combination with other flavours. I wouldn't rawdog an entire tin of anchovies like I would eat a whole jar of pickles onions, they're too strong, but in combination with other pizza toppings they add a zest that I really enjoy. |
Topic | Does this kinda turn you off about the superman character? |
MrMallard 09/10/23 1:50:30 AM #61 | I like Superman for his kindness and humility. Like he might be from another planet, but he had human parents and he knows how it feels to lose someone through means beyond his control. I think the character has become obscured by the insistence that he's too plucky, indestructible and exploitable to be an interesting or good superhero. People only want to see him as the flying brick fascist he's depicted as in the Injustice series, The Dark Knight Returns, BvS and (through an evil parallel character) Crisis on Two Earths, or his dickhead characterisation in the War timeline of the DCAU. First of all, the character can be - and has been - really silly and dumb over the years, just like Batman: https://gamefaqs.gamespot.com/a/user_image/4/7/5/AAbh80AAE09D.jpg Secondly, those characterisations forget his humanity. I can buy Superman becoming a cynical, jaded dickhead in the event of Lois Lane dying, but I don't buy him becoming a dictator who rules over humanity with a race of super-police who disembowel anyone who challenges the regime. I can buy a Superman who's radicalised into fascism via his upbringing and environment - Superman: Cold War is one such setting, where he lands in Soviet Russia and is raised as a Soviet weapon, and later characters like Homelander tackle the concept of a radical nationalist Superman - but I think making the character himself a fascist, opposed to the cynical, distrustful, borderline xenophobic take on Batman as the reader's stand-in for the human race, has done a lot of harm to the perception of Superman as a character. The point of his story becomes "Superman's powers inevitably bore him and corrupt him, and we suffer under his megaton boot", and not "Superman fights every day for humanity, and his humanity and humility in the face of his awesome powers and the burden of his task is what makes him a great hero and what makes the world a better place". It's because he wakes up every day and chooses to be better and to fight for the underdog that makes Superman such an idealistic beacon of hope. And I feel like the assertion that Superman is "boring" or "outdated", and the focus on Superman going bad and another hero having to put down a rogue Superman, has overtaken the original appeal of the character. If you view superheroes solely through the lens of power level and who would win in a fight, it's easy to write Superman off as a bland Mary Sue. But Superman is way more than that, and I think people have forgotten that because the most they see of Superman nowadays is that he's either an asshole, a dictator or the physical manifestation of post-9/11 trauma. Superman had a father who died. He knows he can't save everyone, but he wakes up every day and he tries his best to save the most people. And more than anything, despite his awesome power, he loves and believes in humanity which is why he fights for us. That's the Superman that people forget for the sake of calling him boring, or for the sake of turning him into a big angry goon for Batman to depose. |
Topic | Something that strikes me about 1984's take on dystopia is the language |
MrMallard 09/10/23 12:44:35 AM #3 | GrandConjuraton posted... "socialist brain worms" thoAnother platitude. |
Topic | Something that strikes me about 1984's take on dystopia is the language |
MrMallard 09/10/23 12:34:48 AM #1 | Specifically, how the government bans and cuts out words until dictionaries begin to shrink, controlling thought by controlling language. The right wing love to roll out "thoughtcrime!" and "newspeak!" when people popularise new, more progressive terms to replace old ones which have fallen by the wayside. You can't call gay people or trans people this list of slurs any more, it's the woke thought police exercising mind control through language control! But you have those same people criticising the "rainbow people" for "making shit up", as well as the medical community for defining new disorders and the like - "no-one was autistic in my day, this is just an overreach by big pharma to overmedicate people when they just need a hard dose of reality!". So the right co-opts the point of the newspeak dictionary to say "the fact that calling people slurs isn't allowed is a sign that we're being oppressed". But they don't realise - or, less generously, they know full well - that their pushing back against a broader attempt to catalogue new things in an attempt to better fit in and be able to help others more efficiently is fulfilling exactly what they're supposedly complaining about. With less words to work with, you have less room to discuss and verbalise things - to really flesh them out. The queer community has been able to self-determinate by being able to identify gayness, bisexuality, transgenderism etc. Doctors have been able to remove stigma from mentally challenged people after the right-wing weaponised a medical term as a slur against them, and through the establishment of the autism spectrum, we now have a more robust framework to work with people who have neurological disorders. So dismissive terms against queer and disabled people are fine, and changing language to reflect how those terms have been used for the sake of bigotry is what's leading to "thoughtcrime". But adopting a broader range of terms to describe different queer identities and broadening the scope of different neurological disorders to better treat people of different severities is "newspeak" that's dumbing down the discourse to reduce the efficiency of communication. I would argue the opposite. We have more detailed phrases - and more phrases, period - to respectfully and intuitively discuss different queer identities. We have a broader understanding of autism, the different forms it can take and the severity of the condition - we now have the language to effectively treat the condition, and with our increased understanding of the condition we can now accommodate the needs of autistic people more than ever because we understand autistic people and their condition better than ever. Meanwhile, things we're trying to phase out - slurs - paint a broad picture of something and attach a negative stigma to it, and then end the conversation on that note. They're self-terminating rhetoric that other people find hurtful when used towards themselves, hence the new lingual infrastructure we've built to discuss race, sexuality and disability in a more in-depth way - in a way that reflects the experiences of those groups and fleshes out the experiences that are common to those groups. "Wokeness" has helped a lot of people develop a better understanding of different groups of people, and it did that through new jargon. People expanded the use of language to better describe something that's been made to be nebulous and weird through mainstream ostracization of it. Mentally disabled people are this slur, let's laugh at them based on broad stereotypes and refuse to take disabled people seriously or accommodate their specific disability. Queer people are this slur, they're a stereotype that hurt all the "straight" queers who this slur doesn't apply to (except it does because they're queer and that's still disdainful). Those slurs are closer to newspeak than something "cringy" like grey-asexual homoromantic trans woman. We've established the language to the point that people can express themselves to a broader degree. And we know damn well that people were autistic and had other neurological issues in the past - but they were either labelled as a slur, institutionalised as a defective person or were referred to in hushed tones as the "quiet" uncle, or the "weird" one. That has changed with a broader understanding of mental disability, and people who do suffer from more severe conditions are able to live content lives because time, research and revised treatment has allowed us to facilitate their quality of life - and for that matter, it's allowed those people to facilitate their own quality of life. I write long posts like this because language is all I have. This is how I communicate. If I had to jam myself into a box and express myself in a certain amount of words, or if I had to "dumb it down" to be taken more seriously, I wouldn't be able to properly flesh out my thoughts and feelings. That's one reason why I get so exasperated about people who complain about "the woke police", the same way people scaremongered about "SJWs" as recently as 2018, because they're being judged for oblique, bull-headed and hostile discourse. You have the ability to learn a new concept and understand the language behind it to better understand the concept, but because it's too far out of an unchallenged worldview, you write it off as nonsense and choose to mock it with the same bland, basic platitudes you've been repeating since grade school. The world benefits from a dictionary that has more words in it, and a population who's open to new ideas, concepts and language. The newspeak dictionary in 1984 is slivered down to a fraction of the size it once was through the use of a government censor. The way to combat that kind of information control is to keep adding to the cultural lexicon, keep growing language and fleshing out concepts, and making more descriptive language for future generations to learn and carry with them. |
Topic | Girl MANIPULATES Man & PURPOSELY REJECTS HIM FOR "FUN!" (VIDEO) |
MrMallard 09/09/23 11:23:24 PM #50 | Yeah, I feel when stuff like this comes up it leads to people criticizing women and "dating culture", to the point of saying "this is why meninist/MRA/anti-feminist groups have gained any sort of traction, it's women like these". I see a video like this and an attempt to push it to an embittered mostly male crowd, and I see someone pushing for a volatile, misogynistic reaction. That being said, what she talks about in the video is abhorrent and wrong. It's a shitty thing to do to someone. The issue here is that the way this thread is designed is to whip up the loudest, crankiest reaction possible from the people who'll react to it the worst. It's ragebait. So you have people pre-emptively going "shut the fuck up it's not a problem". And like of course it's a problem when anyone in the dating scene treats another person like this. But keeping in mind that this is a ragebait video, we're talking about one toxic, overconfident woman talking about breaking a man's heart - of which there are certainly more out in the world, because there's a diverse spectrum of people who might be good or bad - compared to a slew of other male content creators who've made misogyny and anti-feminism their platform like Andrew Tate. You have entire movements like "men's rights activists", who don't argue for men's rights as much as they argue that women have too many rights, you have pick-up artists who encourage emotional and mental manipulation to sleep with women, seeing sexual conquest and the objectification of women as the be-all end-all, you have "redpill" ideology which sees the traditional relationship model as giving too much power to women and insisting that women have more "social capital" than men and encouraging "redpills" to fight back against the matriarchal wave that's "poisoning" the media landscape to be anti-men etc. There is a slew of vitriolic, organised groups who are misogynists at best and rape apologists at worst. And the entire time that horseshit has been a problem, you've had dickheads trying to excuse it or downplay it. And you've had those same dickheads posting videos like in the OP to prove that women are just as bad as the "supposed" misogynistic hate groups who get upset over an exaggerated caricature of women like the one in the OP. I think that's where the kneejerk "stfu" reaction responses in this thread come from, and I don't blame them. Ultimately I do want to bring up that people like the woman in the OP do exist, and what she's talking about is a shitty way to treat someone. But let's be real - you're talking about a string of irregular assholes who are just as likely to exist in the world as any other type of woman, used in such a way that an Andrew Tate or an MRA figurehead would paint most/all women in the dating scene to radicalise bitter men into mistreating them. That's what people are criticizing in this thread: this video can easily be used to go "see, women have all the power in the dating scene and men are abused by women like this, but we can't talk about it and we have to defer to women's struggles instead!" - as if this makes up a significant portion of the dating scene or the population of women in general, which it doesn't. It's shitty, but it isn't as systemic and overarching as - say - a man forcing his girlfriend to get a tattoo of him or shave her head, ala someone like Onision or Andrew Tate, and using their experience with those tactics to encourage others to do the same. The behavior of the woman in the OP isn't right. It is a problem. But it's standout examples of mistreatment like this that leads the Andrew Tates and the anti-feminist figureheads and the "meninists" to retaliate against women as a whole with misogyny, violence and abuse, and they're hoping to bring more men into the fold by manipulating their prior experiences and painting their worldview as a solution to a world where women like this get away with anything short of murder because she's a woman. What she talks about doing in this video isn't right. But when you've been around the block enough times, you know when someone is trying to whip up a shitstorm about how women are hypocritical bitches who keep men down through false rape accusations and abuse allegations using their "social capital" to get away with it. I strongly believe the video in the OP wasn't posted in good faith, and as strongly as I might condemn the actions taken by the women in that video, I know ragebait when I see it and I think this topic was made in bad faith. |
Topic | Man gets cucked in BG3 and loses his mind |
MrMallard 09/09/23 3:26:06 PM #13 | Why would you go to the brothel with your girlfriend anyway? |
Topic | tfw you're lonely and have no one to talk to. |
MrMallard 09/09/23 3:11:31 PM #30 | How's your coworker situation? I started a new job almost two years ago, now I'm friends with the coworkers - we go drinking and have barbeques and stuff. I'm still very lonely and maladjusted as a person, but having made those friendships, my life is a bit brighter. Reckon you'd get on with any of your coworkers? |
Topic | Bottoms was absolutely hilarious |
MrMallard 09/09/23 2:58:37 PM #11 | Back in the day, I liked Blockers more than I thought I would. Later on, I saw Booksmart and loved it. It was like the lesbian subplot of Blockers, but better. I feel like if I see Bottoms, I might like it just as much as Booksmart, if not moreso. |
Topic | Been watching The Love Boat. Kinda miss chill, down to earth storytelling on TV |
MrMallard 09/09/23 2:55:23 PM #7 | Looked up the love boat tag on Tumblr and found an okay meme: https://gamefaqs.gamespot.com/a/user_image/0/4/1/AAbh80AAE02R.jpg |
Topic | Been watching The Love Boat. Kinda miss chill, down to earth storytelling on TV |
MrMallard 09/09/23 2:24:34 PM #1 | Like each episode of The Love Boat is a set of interwoven stories taking place on a cruise ship. The stories are different every week, focusing on all facets of romance from courtship to marriage to divorce, with a defined beginning, middle and end. It takes up an hour-long block factoring in time for commercials, and overall it's been pretty entertaining - a good mix of cornball humor, on-screen chemistry and emotional stakes. Nowadays everything's serialised. Some shows are episodic with an ongoing personal storyline between the main cast, like Boston Legal or the Blacklist. It's been like that for a while. Otherwise, I feel like the only shows that are syndicated and episodic - with the occasional status quo shake-up - are stuff like The Simpsons and Family Guy. Like idk, there's something to an anthology format like the Love Boat. You have a framing device with the crew, but you focus on an ever-changing cast of characters with their own quandaries and whatever issues the crew face are about as transient and immediate as the stories at hand. The first episode of the show had the Captain confronted by his ball-busting ex-wife, with one of the three stories being about standing up for his own integrity and eventually patching things up, still divorced but with both having moved on amicably. The episode I'm on now has Julie, the cruise director, necking with this guy who's leading a "Life Begins At 60" group - only for their fling to be continuously interrupted by the rowdy seniors. We're not talking about engagement on the same level as Friends and How I Met Your Mother, but the cast has character and they get time in the spotlight as they ebb and flow through the continuing stories of their passengers. All of those stories are a part of them and they're familiar and entertaining to watch, but it's not like the continuing misadventures of Ross and Rachel. That being said, having seen the IMDB page, I don't doubt that the main characters have their own storylines and stuff in future seasons - maybe some characters find love for good. But the focus on the show, to my knowledge, continues to be about this ever-rotating cast of cruise passengers. There's something refreshing about how self-contained each episode is, enjoying each episode as its own story on its own merits. You don't see a lot of that any more. Like when I think about just about any live-action show that's stuck in my brain over the course of my life - Boston Legal, Eli Stone, Ugly Betty, Gray's Anatomy, Desperate Housewives, Crossing Jordan, Medium, Dirty Sexy Money, House, Lie to Me, the Blacklist, Bull, Hung, Lost among others - there's always that part of the show that's about the characters themselves, then perhaps a broader, episodic plot in the case of House, Boston Legal, Medium and the Blacklist among others, before resolving whatever was plaguing the main characters all episode. And it's not bad at all; I like some of those shows, and I'm planning to watch others on that list. But what I'm seeing of the Love Boat is scratching an itch that I didn't know I had. It's concise, self-contained storytelling. idk, maybe there's room for amateur writers to cut their teeth on episodic TV like that. Everyone wants to be the next prestige series, even after that bubble burst years ago. Sometimes it's nice to see something transient and immediate, a story that you pick up at the start and drop off at the end. It's tacky and cheap, but it's a lost art. I'm also surprised at how much of the original cast is still alive. I guess most of the cast were pretty young in 1977 but outside of the Captain, who himself was middle-aged when the show began, I think just about everyone is still around. Like with that trashy Love Boat themed reality TV show, they brought the cast back to give the contestants tasks to do and stuff - it might be a shitty reality show, but the cast are not only still around, but they're still willing to do Love Boat-related stuff to this day. I read that they've done periodic appearances together ever since the show ended, too. I'm happy to see it - good for them. It probably begins to recycle plots and stuff the longer it goes on, but I still think it's a relic of a more efficient and cozy era of television. Networks want a Titanic or a Mission Impossible on a Days of our Lives budget and half of the episode order - but not everything has to shock and awe the viewer. Not everything can be the first season of True Detective, or the entire run of Avatar: The Last Airbender. Low-stakes nonsense is nice to watch too. Make your shit episodic and syndicate it, make the individual episodes stand on their own, and try and write stakes that mean something to the characters in the moment. And for my money, try and write seperate stories and seperate characters from week to week. Shows like King of Queens and According to Jim have their charm and are comfortable in their own right, but again, there's something to the anthology format that I feel like I've been missing. It's like watching real-world people with real-world problems, like you're watching people's lives unfold instead of the ongoing misadventures of Doug Heffernan, slobby everyman who's designed to appeal to my sensibilities and string me along from episode to episode. Not even reality shows have that sort of thing going, because forming ongoing narratives and character arcs has been a thing in reality TV since at least Survivor. That's my piece. It's almost 4.30 am here and I've just found my limited experience with the Love Boat to be really refreshing. I like how every episode is about a new group of people and their problems, and I appreciate that for an hour-long airing block every week, multiple writers had to write multiple stories that would eventually end up being filmed and portrayed side by side with each other, working as a cohesive whole for that episode before doing the exact same thing the next week. Long story short, I'm being a nerd. |
Topic | The Stones weren't as good as the Beatles but they made better music |
MrMallard 09/09/23 9:43:10 AM #9 | That's like saying that McDonald's is better than Subway, but Subway makes better food |
Topic | How do you feel about warned/suspended topics being BANNED? |
MrMallard 09/09/23 8:04:55 AM #12 | The topics were great. I did my usual douchebag essay length post thing in the last topic about this, but at the end of the day I thought the topics were really entertaining and I thought they served to highlight genuine ills and fuckups that the featured user made. Like while a bunch of them were made to goof on an unhinged meltdown where someone went full lunatic mode, you'd get that special thread from time to time like when VioletMassacre admitted to entering into a relationship where the girl was 14 and he was 19, and then in a later topic - when he was asked if a 12 year old could give informed consent to a sexual relationship - his response to that question was "technically, yes". The topics were funny, and they served to magnify really fucked up takes like that and let people know to stay away from them or otherwise not take them seriously. I liked them. Also congrats to the resident Fandom employee for squashing whatever dissent they can find about themselves on CE, really keeping that community open and thriving: https://gamefaqs.gamespot.com/a/user_image/7/7/0/AAbh80AAE0yC.jpg |
Topic | a 20 minute youtube video about why the design aesthetics of Tekken 2 slaps butt |
MrMallard 09/09/23 7:54:17 AM #3 | Thorhighheels is a mensch. Love this dude's videos. |
Topic | I have officially played and completed the entire classic megaman series |
MrMallard 09/09/23 1:01:53 AM #6 | wanderingshade posted... I think I'm at Megaman X4 and I doesn't feel worth it to go through them because so far one was good and two were "okay".Despite running for eight games, Mega Man X is the poster boy for "games that peaked at the first entry". |
Topic | Activists spray red paint over billionaire Walmart heiress's superyacht. |
MrMallard 09/08/23 11:21:59 AM #17 | I'm sure someone who owns a superyacht has enough money to dry their tears about something like this. |
Topic | How do you feel about "so and so is WARNED" topics being BANNED? |
MrMallard 09/08/23 11:05:42 AM #67 | MedeaLysistrata posted... i don't understand why people like thisI like it because it's funny. Like that's the main motivator behind what I said earlier. The reason I feel that strongly is because when it comes down to it, I think they're funny. |
Topic | How do you feel about "so and so is WARNED" topics being BANNED? |
MrMallard 09/08/23 4:02:12 AM #40 | MrResetti posted... Mallard out here with the manifestomans out here posting that MrMallardesto |
Topic | I got a $576 power bill today |
MrMallard 09/08/23 4:00:14 AM #3 | ThisIsAKnoife posted... Texas?Australia. So yeah we have less valuable dollarydoos, but almost six hundred bucks is almost six hundred bucks y'know. |
Topic | I got a $576 power bill today |
MrMallard 09/08/23 3:55:28 AM #1 | My place has a power meter inside the property, so meter readers usually can't get inside if I'm not home. The company generates a basic estimate and bills me for that much, and since moving in last year I haven't paid a power bill for more than $200. This time, my shifts were arranged in a way where I was home for someone to read my meter. Checked my email today - $576. Almost triple my usual rate. "then stop using so much power numbnuts" - I don't. I have a wifi modem, a minifridge, a computer, a TV (which the computer is connected to) and a game console. I have a phone and a tablet, the former gets charged every day and the latter every few days. That's everything, aside from the flourescent lights, that uses electricity in my house. My coworker lives in a house with two other people, and his provider billed them $1000 - which is already beyond the pale, he had to call up the power company and say he couldn't pay the bill on time. I get that prices are going up, but what the fuck is up with them almost tripling my power bill? I conserve energy, to the point that I don't have a lot of things that generate electricity in the first place. |
Topic | Note from moderator |
MrMallard 09/08/23 3:41:38 AM #24 | At least now we know what's even worse than being an unpaid GameFAQs moderator: |
Topic | Man that topic about 30 years not being enough was peak yikes. |
MrMallard 09/08/23 3:32:22 AM #5 | This reminds me of some guy who just outright peddled anti-semitic conspiracy theories in a thread before dropping a bunch of slurs. It was initially a suspension. |
Topic | How do you feel about "so and so is WARNED" topics being BANNED? |
MrMallard 09/08/23 3:27:32 AM #35 | It's a stupid call. Topics are usually made in the wake of some monumental fuck-up on behalf of the warned, suspended or banned user. It gives people who experienced the fuck-up something to comment on and joke around, it gives outside users an unexpected burst of entertainment, and in a purely business sense it drives user engagement. People have made warned/suspended threads about me at times, and it's fine. I fuck up, sometimes because I cross a line I was toeing a bit too hard. If people get a laugh and a goof at my expense, so be it. It comes with the territory. Regardless of whether these threads are banned or not, some of those monumental fuck-ups go on to define a user anyway. We had a user named Caution who claimed to be a moderate leftist, but when someone busted him for a discord server where he freely used racial slurs and encouraged his friends to do the same, the dude fucking snapped and became a right-wing shitposter. Same with catboy, I thought he was a fairly neutral poster until comments about him taunting black co-workers by imitating a monkey at them came up. Thread or no thread, word travels. The people who I've seen the most consternation from about this practice are users like darkprince45 and a group of posters who seem to flood into his topics to drown out whatever criticism his trolling is attracting. When it's dp or some crony who gets modded, the same tactic of swamping the "warned/suspended" topic happens and there's complaints about how rude and unfair it was. Like if VioletMassacre makes a barely veiled allusion to finding 15 year old girls attractive, that's something that gets dunked on. He doesn't get a pass because "everyone's being mean to me and I find it distasteful that so many people would take the low road" when he gets moderated for that comment. Is it rude? Sure. It often only takes off and reaches a head when someone says or does something incredibly fucked up, and the thread lets other people know whatever monumentally fucked up thing some user did to get warned or suspended. Or shit, if someone says something genuinely innocuous and somehow gets moderated for it, a thread like that attracts positive attention for them. CE is a stupid, fucked up place with stupid, fucked up people. I'm one of them. The threads are amusing and can serve a broader purpose to the community. If you really wanted to kill this shit for good, you might as well make it okay for warned/suspended generals to replace the individual threads, and then ban the practice outright when the shitty little clique who ends up dominating the general eats itself alive in the end. At least you could say "good riddance" to that dumpster fire. |
Topic | Remember INTERWEBUSER? |
MrMallard 09/07/23 10:36:05 PM #49 | EvilResident posted... Arent these topics against TOS nowI'm not gravedancing or discussing any moderation. I'm just bringing up an old user. |
Topic | Remember INTERWEBUSER? |
MrMallard 09/07/23 9:42:14 AM #22 | [LFAQs-redacted-quote] I hope for everyone's sake that's the only similarity he has with xsquader. |
Topic | Tuberville calls out "woke US Navy" |
MrMallard 09/07/23 7:00:13 AM #5 | literally a "no u" argument |
Topic | Remember INTERWEBUSER? |
MrMallard 09/07/23 6:23:47 AM #1 | Dude spent years trolling Mortal Kombat boards and playing dead games to proclaim himself #1 in the fighting game scene, then he ran for office on a qanon platform and got 0% of the vote. |
Topic | If you're unemployed, is applying for jobs a waste of time? |
MrMallard 09/07/23 6:18:12 AM #5 | Applying for jobs at the ground level is an exercise in getting your nuts slapped upside your head every day of your life. A lot of it will be a waste of time, but if you don't already have a job, it's a hoop you have to jump through until you get one - ergo, the broader activity isn't a waste. Job hunting is a waste of time until it isn't. It's a shitty, futile endeavour that leaves you feeling like a used fleshlight, but either way, gotta do it. |
Topic | futurama season 11 episode 7 ODT (spoilers) |
MrMallard 09/07/23 5:22:32 AM #19 | Didn't they have a pandemic episode when Fry develops the common cold, which had been wiped out for centuries resulting in fewer antibodies for the flu in the future population? |
Topic | People demonize pineapple on pizza, but they are missing the REAL enemy.... |
MrMallard 09/07/23 5:19:38 AM #4 | Keep eating your cosmic brownies and drinking your caprisun, lil fella also the OP sounds like dialogue from some really nasty hentai manga |
Topic | ITT: the gun that killed Shinzo Nyabe |
MrMallard 09/07/23 4:16:57 AM #1 | https://gamefaqs.gamespot.com/a/user_image/0/4/6/AAbh80AAE0XG.jpg |
Topic | The Nun 2 drops today and i havent seen a single bit of promotion for it |
MrMallard 09/07/23 3:17:44 AM #20 | The first Nun movie was a trash movie with too much hype, and sans hype I fully expect The Nun 2 to be just as bad. I hear the first two Conjuring movies are good, but all the spinoffs I've sat through are the quintessential picture of the cheap, trashy horror franchise that pumps out cheap shit for a cheap cash-in. |
Topic | Tumblr Gold is no longer a joke |
MrMallard 09/07/23 12:43:23 AM #25 | Bio1590 posted... Meanwhile I'm over here not giving a shit what the dashboard looks like because 95% of my use is through the app.Pretty sure it affects the app's dash too, that's the thing. We might have both gotten lucky. |
Topic | Tumblr Gold is no longer a joke |
MrMallard 09/06/23 11:07:58 PM #17 | Hayame_Zero posted... Yeah, that's why it plummeted into near-obscurity.tbf the Tumblr fanbase celebrated when that sale happened. Every one of us was a little bit responsible for Yahoo losing one billion dollars. They did it themselves, and the porn ban has fucked the website over to this day, but the fact they lost a cool billion on fucking Tumblr is hilarious. |
Topic | Tumblr Gold is no longer a joke |
MrMallard 09/06/23 11:07:03 PM #16 | The CEO is also deflecting criticism about the myriad of recent problems users have had with the site: https://gamefaqs.gamespot.com/a/user_image/9/0/7/AAbh80AAE0U7.png Meanwhile dude has been stripping functionality from the site and the app, including a worse dashboard that mimics Twitter's layout. Half of the userbase got the new dash and the other half didn't, I'm one of the lucky ones who didn't. |
Topic | Tumblr Gold is no longer a joke |
MrMallard 09/06/23 10:31:26 PM #1 | https://gamefaqs.gamespot.com/a/user_image/8/9/2/AAbh80AAE0Us.jpg Welcome to your future, gamefaqs |
Topic | Hogwarts Legacy players frustrated as Starfield and Baldur's Gate 3 outshine |
MrMallard 09/06/23 11:03:37 AM #30 | It's a bummer that the game they liked so much ended up being a retroactive dud, but they're more than welcome to pick up a new game with these new features. And frankly, I have less sympathy for them than even Diablo 4 fans whose game was actively fucked in the ass post-launch by the developers. I don't know why a single Reddit thread about users feeling sad that other games are better than theirs is being presented as news. |
Topic | People want to use Android, but don't want the stigma of being a green bubble |
MrMallard 09/06/23 7:27:09 AM #36 | The whole green bubbles vs blue bubbles thing is tribalism and groupthink at its most stupid point.
Like what the fuck is wrong with us where we have people bullying and excluding people over a cosmetic change depending on phone brand? --- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | Mortal Kombat 1 base roster + kameo fighters leaked |
MrMallard 09/06/23 7:23:29 AM #4 | Doom_Art posted...
Kameo: Elements of Power?Yeah, Kameo flies in and rips off your opponent's head if you do a special button input. Then she casts a spell and a flower grows out of your neck. (note to mods, I'm kidding) Kameo fighters, from what I've seen, are basically a power-up where you can tag in a non-playable character to do a move. Like you'll be playing as Sub-Zero with a Kameo fighter of Jax, and you can occasionally tag Jax in to do a move or two before you jump back to Sub-Zero. My understanding is that these Kameos also have their own Fatalities, so while you have a lower amount of playable characters, you have a ton of fatalities. I'm not really sold on this system. NetherRealm Studios say that they did this instead of tag-team battles because tag battles had low user engagement in MK9, but it seems like kind of a superfluous system that relegates fan favourite characters to NPC status, with them being "technically" playable with their own fatalities as a consolation prize. But only time will tell if this system is any good or not. --- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | Mortal Kombat 1 base roster + kameo fighters leaked |
MrMallard 09/06/23 7:16:28 AM #1 | There's nothing too crazy in the leaks, it's just the roster of fighters. There's a couple of spoilery character thumbnails but that's about it.
I won't spoil anything about the kameo fighters, but there's one really fucking cool kameo. The others are fine. --- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | Memes #41 |
MrMallard 09/06/23 6:49:49 AM #37 | https://gamefaqs.gamespot.com/a/user_image/3/3/1/AAbh80AAE0L7.jpg
--- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | What's the most "American" movie? |
MrMallard 09/05/23 3:15:09 AM #52 | Adam Sandler's Jack and Jill
--- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | Memes #41 |
MrMallard 09/04/23 9:12:28 AM #19 | https://gamefaqs.gamespot.com/a/user_image/9/1/3/AAbh80AAEz1x.jpg
--- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | This meme sums up how it feels when I bump into old classmates |
MrMallard 09/04/23 8:41:58 AM #3 | https://gamefaqs.gamespot.com/a/user_image/9/0/9/AAbh80AAEz1t.jpg
--- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | Did you know that Yoko Shimomura did the soundtrack for Street Fighter 2? |
MrMallard 09/04/23 6:44:21 AM #3 | My guess would be her. I could definitely be wrong but I think she was the lead on this game, and Isao Abe was the assistant.
--- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Topic | Did you know that Yoko Shimomura did the soundtrack for Street Fighter 2? |
MrMallard 09/04/23 6:40:44 AM #1 | According to Wikipedia it was her and someone named Isao Abe. Pretty sure she wasn't credited for decades.
--- All I can eat is the poisonous apple, and that's not a story that I'm meant to survive. |
Board List |