Topic List |
Page List:
1 |
---|---|
Trumble 09/10/23 2:54:51 AM #1: |
Then we can tell each other who's ayaowbsws or estmrf or hqjj3e without the mods knowing what we're up to.
--- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
LordFarquad1312 09/10/23 2:56:53 AM #2: |
Heteroflexible el que lo lea.
--- El sexo sucio y el planeta limpio. "If you are tired of fear from links... Let Kirby's Nightmare protect you." ... Copied to Clipboard!
|
A_Good_Boy 09/10/23 2:57:31 AM #3: |
umbletray isyay uspendedsay
--- Who is? I am! ... Copied to Clipboard!
|
Trumble 09/10/23 2:58:10 AM #4: |
A_Good_Boy posted...
umbletray isyay uspendedsayOuryay acefay isyay uspendedsay. --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
MICHALECOLE 09/10/23 2:58:13 AM #5: |
Instead of saying suspended lets say absorbed by the blob So and so has been ABSORBED BY THE BLOB! ... Copied to Clipboard!
|
Smashingpmkns 09/10/23 2:58:27 AM #6: |
I don't speak dumb
--- http://i.imgur.com/x04tPRZ.jpg http://i.imgur.com/t7T392I.jpg ... Copied to Clipboard!
|
evilpresident 09/10/23 2:58:35 AM #7: |
Just communicate through interpretive dance.
--- Nothing to report here ... Copied to Clipboard!
|
Trumble 09/10/23 2:58:50 AM #8: |
MICHALECOLE posted...
Instead of saying suspended lets say absorbed by the blobNo we need an entire language. If it's just a code phrase they can figure it out from context. --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
Irony 09/10/23 2:58:57 AM #9: |
Par adgt't om oi
--- See profile pic ... Copied to Clipboard!
|
Priere 09/10/23 3:00:25 AM #10: |
Omlette du fromage
--- https://imgur.com/iQep35u https://i.imgur.com/PmX8smn.gif https://i.imgur.com/mwTy0iF.gif https://i.imgur.com/FCER80e.gif ... Copied to Clipboard!
|
Trumble 09/10/23 3:01:00 AM #11: |
Priere posted...
Omlette du fromage --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
Priere 09/10/23 3:01:52 AM #12: |
Trumble posted...
If water takes the path of least resistance, why isn't France totally flooded? --- https://imgur.com/iQep35u https://i.imgur.com/PmX8smn.gif https://i.imgur.com/mwTy0iF.gif https://i.imgur.com/FCER80e.gif ... Copied to Clipboard!
|
Trumble 09/10/23 3:02:12 AM #13: |
Priere posted...
If water takes the path of least resistance, why isn't France totally flooded?Because you touch yourself at night. --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
MICHALECOLE 09/10/23 3:02:15 AM #14: |
Trumble posted... No we need an entire language. If it's just a code phrase they can figure it out from context.no theyre not smart enough for that and instead of mods lets say melted ice cream sandwiches melted ice cream sandwiches arent smart enough to figure out our secret code ... Copied to Clipboard!
|
Trumble 09/10/23 3:04:42 AM #15: |
But what about the avocado smoothies?
--- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
Shotgunnova 09/10/23 3:05:10 AM #16: |
Yakka foob mog. Grug pubbawup zink wattoom gazork. Chumble spuzz.
--- Take me down from the ridge where the summer ends And watch the city spread out just like a jet's flame ... Copied to Clipboard!
|
Trumble 09/10/23 3:05:54 AM #17: |
^ Cute attempt, but you forgot to cromulate the verbjective.
--- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
MICHALECOLE 09/10/23 3:06:02 AM #18: |
Guys dont say anything a melted ice cream sandwich is listening dont want to end up absorbed by the blob ... Copied to Clipboard!
|
Priere 09/10/23 3:06:14 AM #19: |
Trumble posted...
Because you touch yourself at night. https://imgur.com/a/oLap54H --- https://imgur.com/iQep35u https://i.imgur.com/PmX8smn.gif https://i.imgur.com/mwTy0iF.gif https://i.imgur.com/FCER80e.gif ... Copied to Clipboard!
|
A_Good_Boy 09/10/23 3:07:41 AM #20: |
Cole me on the panny sty.
--- Who is? I am! ... Copied to Clipboard!
|
Lillymon 09/10/23 3:13:38 AM #21: |
We could just use Dutch. It's indistinguishable from a fictional language anyway. Observe.
We kunnen ook gewoon Nederlands gebruiken. Het is toch niet te onderscheiden van een fictieve taal. Observeer. --- "Bothering people when they're shopping or going to work or whatever because you find them attractive makes you scum of the earth." MegatokyoEd ... Copied to Clipboard!
|
toreysback 09/10/23 3:29:05 AM #22: |
ih
--- my memory not so good no more - that's all i can remember for now ... Copied to Clipboard!
|
evilpresident 09/10/23 3:31:48 AM #23: |
Lillymon posted...
We could just use Dutch. It's indistinguishable from a fictional language anyway. Observe.Goed idee --- Nothing to report here ... Copied to Clipboard!
|
DeadBankerDream 09/10/23 3:32:27 AM #24: |
Vilg oui!
--- "That thick shaft that causes women to shudder!" ... Copied to Clipboard!
|
Trumble 09/10/23 4:07:10 AM #25: |
DeadBankerDream posted...
Hu o --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
tripleh213 09/10/23 4:10:35 AM #26: |
Cant do anything here anymore...
--- Bucks World Champions 2021 PS4 looks great ... Copied to Clipboard!
|
#27 | Post #27 was unavailable or deleted. |
DuuuDe14 09/10/23 4:40:12 AM #28: |
https://gamefaqs.gamespot.com/a/user_image/5/9/8/AAXV7yAAEoC2.jpg
--- The Official Sons of Sparda of all GameFAQS boards. June 10, 2018. The day Dante returned to us. Do what you want, just don't expect to get paid. ... Copied to Clipboard!
|
viewmaster_pi 09/10/23 4:43:10 AM #29: |
if we talk like star wars aliens, mods won't understand. babakusa mawbata palluwando bambo mawambapabu gamefaqs mods abombulamba chumbawamba
--- The stone that fell is still falling, so let that stone be a wondrous thing ... Copied to Clipboard!
|
Agonized_rufous 09/10/23 4:56:42 AM #30: |
Gris it
--- "All I have is my balls and my word, and I don't break them for anyone!"-Tony Montana ... Copied to Clipboard!
|
Rai_Jin 09/10/23 5:05:59 AM #31: |
tc is sus. ... Copied to Clipboard!
|
Trumble 09/10/23 5:52:22 AM #32: |
Rai_Jin posted...
tc is sus.Fuck off. --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
Guide 09/10/23 5:59:06 AM #33: |
I mean, we could just encrypt all the shit. Would make using the boards a chore tho.
--- evening main 2.4356848e+91 https://youtu.be/Acn5IptKWQU ... Copied to Clipboard!
|
uwnim 09/10/23 8:00:25 AM #34: |
There's one problem. The admins, in their infinite wisdom, decreed that such posts would be considered Disruptive Posting and shall be deleted.
--- I want a pet Lavos Spawn. [Order of the Cetaceans: Phocoena dioptrica] ... Copied to Clipboard!
|
MrMallard 09/10/23 8:25:15 AM #35: |
We should start speaking in genome sequences. ATGATACTGATGCATACGTACGTACGATCATCG ... Copied to Clipboard!
|
party_animal07 09/10/23 8:26:33 AM #36: |
https://youtu.be/uA2DrMuirx4?feature=shared
--- https://warpzone.me/wp-content/uploads/2018/08/GRANDIA_-696x509.jpg ... Copied to Clipboard!
|
Trumble 09/10/23 4:08:16 PM #37: |
uwnim posted...
There's one problem. The admins, in their infinite wisdom, decreed that such posts would be considered Disruptive Posting and shall be deleted.I think it's been specifically stated that non-English posts are fine. Based on that Al Bhed and Klingon have been tolerated I'd say that extends to conlangs too. --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
Priere 09/10/23 4:10:44 PM #38: |
uwnim posted...
There's one problem. The admins, in their infinite wisdom, decreed that such posts would be considered Disruptive Posting and shall be deleted.Its 2023. We can just browbeat them and use new speak to convince them that they are being some kind of phobic against different cultures. That would tarnish Fandoms image and they will cuck out and bow to our new language. --- https://imgur.com/iQep35u https://i.imgur.com/PmX8smn.gif https://i.imgur.com/mwTy0iF.gif https://i.imgur.com/FCER80e.gif ... Copied to Clipboard!
|
Trumble 09/10/23 4:12:21 PM #39: |
Priere posted...
Its 2023.Wouldn't work. Individual mods may vary but the general trend is for a reasonable level of tolerance and protection, not "if you're [some identity] you can get away with anything" like ResetEra would do. --- You can't spell Trumble without several letters of the English alphabet. ... Copied to Clipboard!
|
Cobra1010 09/10/23 5:22:16 PM #40: |
Trumble posted...
Then we can tell each other who's ayaowbsws or estmrf or hqjj3e without the mods knowing what we're up to. Then how are you supposed to insult someone and have them understand it without getting grassed on? --- Load me into the matrix and dont pull the plug ... Copied to Clipboard!
|
toreysback 09/10/23 5:44:30 PM #41: |
Cobra1010 posted...
Then how are you supposed to insult someone and have them understand it without getting grassed on? after saying eep op ork ah ah or whatever then add "some may choose to take this as an insult" --- my memory not so good no more - that's all i can remember for now ... Copied to Clipboard!
|
VampireCoyote 09/10/23 5:45:18 PM #42: |
Klemdowb, chankt
--- She/her ... Copied to Clipboard!
|
Topic List |
Page List:
1 |